shgfp (Addgene inc)
Addgene inc is a verified supplier 
90
Structured Review
Addgene inc
shgfp
Shgfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shgfp/shgfp/pmc12204135-300-1-8
Average 90 stars, based on 1 article reviews
Shgfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shgfp/shgfp/pmc12204135-300-1-8
Average 90 stars, based on 1 article reviews
shgfp - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Expressing:Article Title: Oncogenic enhancers prime quiescent metastatic cells to escape NK immune surveillance by eliciting transcriptional memory. Article Snippet: .. Cells expressing shRNAs against SOX9 or GFP were obtained transducing MD cells with the lentiviral vector pLKO.1 shSOX9 (Addgene #40644) or Infection:Article Title: Oncogenic enhancers prime quiescent metastatic cells to escape NK immune surveillance by eliciting transcriptional memory. Article Snippet: .. Cells expressing shRNAs against SOX9 or GFP were obtained transducing MD cells with the lentiviral vector pLKO.1 shSOX9 (Addgene #40644) or Article Title: Breast cancer cell resistance to hormonal and targeted therapeutics is correlated with the inactivation of the NR6A1 axis. Article Snippet: .. To exclude the off-target effects of NR6A1 shRNAs, we used the parallel infection with virion particles formed by the same lentiviral vector-coding Control:Article Title: Fatty acid oxidation regulates cellular senescence by modulating the autophagy-SIRT1 axis Article Snippet: .. The sequences for shRNAs are as follows. shCPT1A #1 5’-CCGGGGATGGGTATGGTCAAGATCTCTCGAGAGATCTTGACCATACCCATCCTTTTT-3’; shCPT1A #2 5’-CCGGGGTGGTTTGACAAGTCGTTCACTCGAGTGAACGACTTGTCAAACCACCTTTTT-3’. Article Title: Fatty acid oxidation regulates cellular senescence by modulating the autophagy-SIRT1 axis Article Snippet: .. The sequences for shRNAs are as follows. shCPT1A #1 5’-CCGGGGA TGGGTATGGTCAAGATCTCTCGAGAGATCTTGACCATACC CATCCTTTTT-3’; shCPT1A #2 5’-CCGGGGTGGTTTGACAAGTC GTTCACTCGAGTGAACGACTTGTCAAACCACCTTTTT-3’. Article Title: The BET Inhibitor JQ1 Potentiates the Anticlonogenic Effect of Radiation in Pancreatic Cancer Cells Article Snippet: .. Briefly, Panc1 cells were transfected using PEI (Polysciences Inc., Warrington, VA, USA) and Mission shRNA (Millipore Sigma) targeting BRD2 or BRD4. Plasmid Preparation:Article Title: Breast cancer cell resistance to hormonal and targeted therapeutics is correlated with the inactivation of the NR6A1 axis. Article Snippet: .. To exclude the off-target effects of NR6A1 shRNAs, we used the parallel infection with virion particles formed by the same lentiviral vector-coding Article Title: VIRMA-mediated m 6 A modification regulates forebrain formation through modulating ribosome biogenesis Article Snippet: The AAV-shRNA vector (AAV: ITR-CMV-Cerulean-SV40-shRNA-U6-ITR), as described in a previous study , was generously provided by J. Xia from Hong Kong University of Science and Technology (Guangzhou). .. The shCON used here was shRNA:Article Title: Breast cancer cell resistance to hormonal and targeted therapeutics is correlated with the inactivation of the NR6A1 axis. Article Snippet: .. To exclude the off-target effects of NR6A1 shRNAs, we used the parallel infection with virion particles formed by the same lentiviral vector-coding Article Title: The BET Inhibitor JQ1 Potentiates the Anticlonogenic Effect of Radiation in Pancreatic Cancer Cells Article Snippet: .. Briefly, Panc1 cells were transfected using PEI (Polysciences Inc., Warrington, VA, USA) and Mission shRNA (Millipore Sigma) targeting BRD2 or BRD4. Sequencing:Article Title: Breast cancer cell resistance to hormonal and targeted therapeutics is correlated with the inactivation of the NR6A1 axis. Article Snippet: .. To exclude the off-target effects of NR6A1 shRNAs, we used the parallel infection with virion particles formed by the same lentiviral vector-coding Transfection:Article Title: The BET Inhibitor JQ1 Potentiates the Anticlonogenic Effect of Radiation in Pancreatic Cancer Cells Article Snippet: .. Briefly, Panc1 cells were transfected using PEI (Polysciences Inc., Warrington, VA, USA) and Mission shRNA (Millipore Sigma) targeting BRD2 or BRD4. |